Sequence ID | >C015839 |
Genome ID | CP000082 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Psychrobacter arcticus 273-4 [CP000082] |
Start position on genome | 199838 |
End posion on genome | 199763 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
tagacattac |
tRNA gene sequence |
AGGGGTATAGCCAAGTTGGTAAGGCATCAGGTTTTGATCCTGACATCCGTTGGTTCGAGT |
Downstream region at tRNA end position |
ttttttactg |
Secondary structure (Cloverleaf model) | >C015839 Gln TTG c ACCA ttttttactg A - T G - C G - C G - C G - C T - A A - T T G T C G A C C A T G A A | + | | | G T A C C G G T T G G C G | | | T T G A G G C T A A CATCC T - A C - G A - T G - C G - C T T T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |