Sequence ID | >C016782 |
Genome ID | CP000551 |
Search identical group | |
Phylum/Class | Cyanobacteriota |
Species | Prochlorococcus marinus str. AS9601 [CP000551] |
Start position on genome | 829984 |
End posion on genome | 830070 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
agttatcttg |
tRNA gene sequence |
GGAGAGGTGGCCGAGTGGTTGAAGGCGCAGCACTGGAAATGCTGTATAGGGGCAACTTTA |
Downstream region at tRNA end position |
tatattagtt |
Secondary structure (Cloverleaf model) | >C016782 Ser GGA g Gttt tatattagtt G - C G - C A - T G - C A - T G - C G + T T A T C T C C C A T G A G | | | | | G G G C C G G A G G G C G | | | T T T A G G C T G A G TATAGGGGCAACTTTATC C - G A - T G - C C - G A - T C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |