Sequence ID | >C017128 |
Genome ID | CP000095 |
Search identical group | |
Phylum/Class | Cyanobacteriota |
Species | Prochlorococcus marinus str. NATL2A [CP000095] |
Start position on genome | 826578 |
End posion on genome | 826650 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
tcatttcgag |
tRNA gene sequence |
GCGGGTGTCGCCAAGTGGTTAAGGCAGCGGCTTGTGGTGCCGCCATCCGGGGGTTCGAAT |
Downstream region at tRNA end position |
aaattctttg |
Secondary structure (Cloverleaf model) | >C017128 His GTG g Cctc aaattctttg G - C C - G G - C G - C G + T T - A G - C T A T T C C C C A T G A C + | | | | G G A C C G G G G G G C G | | | T T T A G G C T A A CATCC G - C C - G G - C G - C C - G T T T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |