| Sequence ID | >C017426 |
| Genome ID | CP000422 |
| Phylum/Class | Bacillota |
| Species | Pediococcus pentosaceus ATCC 25745 [CP000422] |
| Start position on genome | 705141 |
| End posion on genome | 705214 |
| Amino Acid | Gly |
| Anticodon | CCC |
| Upstream region at tRNA start position |
taactcatat |
| tRNA gene sequence |
GCGAATGTAGTTTAGTGGTAAAATTCAAGCTTCCCAAGCTTGTGTCGCGGGTTCGATTCC |
| Downstream region at tRNA end position |
ctgaaaaaca |
| Secondary structure (Cloverleaf model) | >C017426 Gly CCC
t TTCA ctgaaaaaca
G - C
C - G
G - C
A - T
A - T
T - A
G - C T T
T T G C C C A
G A A + | | | | G
T T T T G G C G G G C
G | | | + T T
G A A A T
T A T TGTC
C - G
A - T
A - T
G - C
C - G
T A
T A
C C C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [Ensembl] |
| Comment | |
| --- | |
| Input Comment |