Sequence ID | >C018369 |
Genome ID | CP000362 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Roseobacter denitrificans OCh 114 [CP000362] |
Start position on genome | 3427558 |
End posion on genome | 3427641 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
tcggcagcgt |
tRNA gene sequence |
GGGCGACAGGCCGCAAGGTGTGGCAGGGGACTGTAACTCCCTCGCGGAGACGCACGCCTG |
Downstream region at tRNA end position |
ttttctgaca |
Secondary structure (Cloverleaf model) | >C018369 Tyr GTA t ACCA ttttctgaca G - C G - C G - C C - G G - C A - T C - G T T A G G A C C A A C G | | | | | G A G C C G C C T G G C G + | | | T T G T G G C T G A CGCGGAGACGCACG G + T G - C G - C G - C A - T C C T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |