| Sequence ID | >C024941 |
| Genome ID | CP000473 |
| Phylum/Class | Acidobacteriota |
| Species | Candidatus Solibacter usitatus [CP000473] |
| Start position on genome | 709622 |
| End posion on genome | 709547 |
| Amino Acid | Met |
| Anticodon | CAT |
| Upstream region at tRNA start position |
atgagggctc |
| tRNA gene sequence |
GGGCCCTTAGCTCAGCGGTTAGAGCCGCGGACTCATAATCCGTTGGTCGCTGGTTCAAAT |
| Downstream region at tRNA end position |
acaacctcaa |
| Secondary structure (Cloverleaf model) | >C024941 Met CAT
c ACCA acaacctcaa
G - C
G - C
G - C
C - G
C - G
C - G
T - A T A
T C G A C C A
C G A A | | | | | A
G C T C G G C T G G C
G | | | | T T
T G A G C
T A C TGGTC
G + T
C - G
G - C
G - C
A - T
C A
T A
C A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [Ensembl] |
| Comment | |
| --- | |
| Input Comment |