Sequence ID | >C025129 |
Genome ID | CP000097 |
Search identical group | |
Phylum/Class | Cyanobacteriota |
Species | Synechococcus sp. CC9902 [CP000097] |
Start position on genome | 435379 |
End posion on genome | 435460 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
aatcgaccac |
tRNA gene sequence |
GCGGATGTGGTGGAATTGGTAGACACGCACGTTTGAGGGGCGTGTGGCTTCGGCCTTGCG |
Downstream region at tRNA end position |
cattcttttg |
Secondary structure (Cloverleaf model) | >C025129 Leu GAG c Attt cattcttttg G - C C - G G - C G - C A - T T - A G - C T G T C G C T C A T A A G | | | | | A T G G T G G C G A G C G | | | T T G A C A C T A G G TGGCTTCGGCCTT C - G A - T C - G G - C T + G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |