Sequence ID | >C025517 |
Genome ID | BA000039 |
Search identical group | |
Phylum/Class | Cyanobacteriota |
Species | Thermosynechococcus vestitus BP-1 [BA000039] |
Start position on genome | 1621556 |
End posion on genome | 1621627 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
ttgctgatat |
tRNA gene sequence |
TCCTCAGTAGCTCAGCGGTAGAGCGGTCGGCTGTTAACCGATTGGTCGCTGGTTCGAATC |
Downstream region at tRNA end position |
aataactgga |
Secondary structure (Cloverleaf model) | >C025517 Asn GTT t Gttt aataactgga T - A C - G C - G T + G C - G A - T G - C T A T C G A C C A G A A | | | | | G C C T C G G C T G G C G | | | | T T G G A G C T A G TGGTC G + T T - A C - G G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |