| Sequence ID | >WENV014793 |
| Genome ID | AACY020413034 |
| Phylum/Class | Marine microbial communities from Global Ocean Sampling (GOS) |
| Species | |
| Start position on genome | 1163 |
| End posion on genome | 1240 |
| Amino Acid | Asn |
| Anticodon | GTT |
| Upstream region at tRNA start position |
aagtttacaT |
| tRNA gene sequence |
TCCTCGGTAGCTCAGTTGGTAGAGCAGTTGACTGTTAATCAATTGGTCGCAGGTTCGAGT |
| Downstream region at tRNA end position |
Aaaaaattta |
| Secondary structure (Cloverleaf model) | >WENV014793 Asn GTT
T GCCA Aaaaaattta
T - A
C - G
C - G
T - A
C - G
G - C
G - C T G
T C G T C C A
T G A A | | | | | G
T C T C G G C A G G C
G | | | | T T
G G A G C
T A A TGGTC
G + T
T - A
T - A
G - C
A - T
C A
T A
G T T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |