Sequence ID | >w024149 |
Genome ID | AAYJ01000006 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Coxiella burnetii RSA 334 [AAYJ] |
Start position on genome | 62772 |
End posion on genome | 62850 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
ttcatgacgC |
tRNA gene sequence |
GCGCCCGTAGCTCAGTTGGATAGAGTACCTGGCTACGAACCAGGGGGTCGGCGGTTCGAA |
Downstream region at tRNA end position |
Agaatgtaag |
Secondary structure (Cloverleaf model) | >w024149 Arg ACG C GCCA Agaatgtaag G - C C - G G - C C - G C - G C - G G - C T A T C T G C C A T G A A | + | | | G T C T C G G G C G G C G | | | + T T G G A G T A T A A GGGTC C - G C - G T - A G - C G - C C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |