Sequence ID | >w023318 |
Genome ID | AAXU01000003 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Algoriphagus machipongonensis PR1 [AAXU] |
Start position on genome | 333035 |
End posion on genome | 333114 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
aaaacatatT |
tRNA gene sequence |
GGGAGTTTAGCTCAGTTGGTTCAGAGCATCTGCCTTACAAGCAGAGGGTCGGGGGTTCGA |
Downstream region at tRNA end position |
Cctagtaaat |
Secondary structure (Cloverleaf model) | >w023318 Val TAC T ACAT Cctagtaaat G - C G - C G - C A - T G - C T - A T - A T A T C T C C C A T T G A A | + | | | G G C T C G G G G G G C G | | | | T T T G A G C T C A A GGGTC T - A C - G T - A G - C C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |