Sequence ID | >w016793 |
Genome ID | AAQP01000023 |
Phylum/Class | Alphaproteobacteria |
Species | Wolbachia endosymbiont of Drosophila willistoni of Drosophila willistoni TSC#14030-0811.24 [AAQP] |
Start position on genome | 3517 |
End posion on genome | 3440 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
aaaatgaaaT |
tRNA gene sequence |
GATCCCGTAGCTCAGCCGGTAGAGCAACTGACTTTTAATCAGTGGGTCACGCGTTCGAAT |
Downstream region at tRNA end position |
Acaaattttg |
Secondary structure (Cloverleaf model) | >w016793 Lys TTT T ACTC Acaaattttg G - C A - T T - A C - G C - G C - G G - C T A T T G C G C A C G A A | | | | | G C C T C G A C G C G C G | | | | T T G G A G C T A A GGGTC A - T C - G T - A G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |