Sequence ID | >w016792 |
Genome ID | AAQP01000023 |
Phylum/Class | Alphaproteobacteria |
Species | Wolbachia endosymbiont of Drosophila willistoni of Drosophila willistoni TSC#14030-0811.24 [AAQP] |
Start position on genome | 3857 |
End posion on genome | 3934 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
agaattaccT |
tRNA gene sequence |
GGGGGTATAGCTCAGCTGGTAGAGCATCTGTTTTGCACGCAGAAGGTCAGCGGTTCGATC |
Downstream region at tRNA end position |
Gtctatacag |
Secondary structure (Cloverleaf model) | >w016792 Ala TGC T ACCA Gtctatacag G - C G - C G + T G - C G - C T + G A - T C T T T C G C C A C G A A | | | | | G T C T C G A G C G G C G | | | | T T G G A G C T A A AGGTC T - A C - G T - A G - C T + G T C T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |