Sequence ID | >w013223 |
Genome ID | AAND01000048 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Vibrio sp. MED222 [AAND] |
Start position on genome | 21711 |
End posion on genome | 21630 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
aggaaataaa |
tRNA gene sequence |
GCGGTCGTGGCGGAATTGGTAGACGCACCAGATTTAGGTTCTGGCGCCGAGAGGTGTGAG |
Downstream region at tRNA end position |
tattgagatg |
Secondary structure (Cloverleaf model) | >w013223 Leu TAG a Acca tattgagatg G - C C - G G - C G - C T - A C - G G - C T G T C T C T C A T A A G | | | | | A T G G C G G A G A G C G | | | T T G A C G C T A G A CGCCGAGAGGTGT C - G C - G A - T G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |