| Sequence ID | >w012583 |
| Genome ID | AAMP01000002 |
| Phylum/Class | Bacteroidota |
| Species | Croceibacter atlanticus HTCC2559 [AAMP] |
| Start position on genome | 709652 |
| End posion on genome | 709574 |
| Amino Acid | His |
| Anticodon | GTG |
| Upstream region at tRNA start position |
attacaaatG |
| tRNA gene sequence |
GTGGTTGTAGCTCAGCTGGTTAGAGCGCTGGTTTGTGGTACCAGAAGTCGCCGGTTCGAA |
| Downstream region at tRNA end position |
Aataaaagcc |
| Secondary structure (Cloverleaf model) | >w012583 His GTG
G CCAA Aataaaagcc
G - C
T - A
G - C
G - C
T T
T T
G - C C A
T T G G C C A
C G A A + | | | | G
T C T C G G C C G G C
G | | | | T T
G G A G C
T T A G AAGTC
C - G
T - A
G - C
G - C
T - A
T T
T G
G T G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |