Sequence ID | >w010207 |
Genome ID | AAKQ01000074 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Thermoanaerobacter pseudethanolicus ATCC 33223 [AAKQ] |
Start position on genome | 2152 |
End posion on genome | 2227 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
gtcgaggcgC |
tRNA gene sequence |
TGCCGAATGGTGTAATGGTAGCACAGGTGACTCTGGATCATCTAGTCTAGGTTCGAGTCC |
Downstream region at tRNA end position |
Ttttggcccc |
Secondary structure (Cloverleaf model) | >w010207 Gln CTG C GCCA Ttttggcccc T - A G - C C - G C - G G - C A - T A - T T G T G A T C C A A A G | | | | | G T T G T G C T A G G C G + | | | T T G G C A C T A A TAGT G - C G + T T - A G - C A - T C A T G C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |