Sequence ID | >C171032159 |
Genome ID | CP014529 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Enterococcus faecium E745 [CP014529] |
Start position on genome | 1346660 |
End posion on genome | 1346733 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
gcaacaacca |
tRNA gene sequence |
CTACCCTTAGCTCAGTTGGTCAGAGCAGACGGCTCATAACCGTCCGGTCGTAGGTTCGAG |
Downstream region at tRNA end position |
atgtagccaa |
Secondary structure (Cloverleaf model) | >C171032159 Met CAT a Atta atgtagccaa C C T - A A - T C - G C - G C - G T - A T G T C A T C C A T G A A | | | | | G T C T C G G T A G G C G | | | | T T G G A G C T C A A CGGTC G - C A - T C - G G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |