Sequence ID | >C171099352 |
Genome ID | CP019768 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Corynebacterium pseudotuberculosis phoP [CP019768] |
Start position on genome | 321579 |
End posion on genome | 321653 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
gggagattgg |
tRNA gene sequence |
GGCGGTGTAGCTCAGTGGTAGAGCAAGCGACTCATAATCGCTGTGTCGCGAGTTCAATTC |
Downstream region at tRNA end position |
gggaatatgc |
Secondary structure (Cloverleaf model) | >C171099352 Met CAT g ACTA gggaatatgc G + T G - C C - G G - C G + T T - A G - C T T T C G C T C A G A A | | | | | A T C T C G G C G A G C G | | | | T T G G A G C T A A GTGTC A - T G - C C - G G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |