| Sequence ID | >C171118240 |
| Genome ID | CP021366 |
| Phylum/Class | Betaproteobacteria |
| Species | Acidovorax carolinensis P4 [CP021366] |
| Start position on genome | 863468 |
| End posion on genome | 863392 |
| Amino Acid | Met |
| Anticodon | CAT |
| Upstream region at tRNA start position |
attgctcttc |
| tRNA gene sequence |
GGTGATATAGCTCAGTTGGTTAGAGCGCAGCATTCATAATGCTGATGTCGGTGGTTCAAA |
| Downstream region at tRNA end position |
attcagaagc |
| Secondary structure (Cloverleaf model) | >C171118240 Met CAT
c ACCA attcagaagc
G - C
G - C
T - A
G - C
A - T
T - A
A - T T A
T C C A C C A
T G A A | | | | | A
T C T C G G G T G G C
G | | | | T T
G G A G C
T T A G ATGTC
C - G
A - T
G - C
C - G
A - T
T A
T A
C A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | - |
| Comment | |
| --- | |
| Input Comment |