Sequence ID | >WENV180004176 |
Genome ID | FLRQ01109113 |
Search identical group | |
Phylum/Class | [FLRQ] metagenome; saliva |
Species | |
Start position on genome | 1663 |
End posion on genome | 1748 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
caacccaaat |
tRNA gene sequence |
GCCTGGGTGGCGAAATTGGTAGACGCAGCGGATTCAAAATCCGCCGGTGAATAACCGTGT |
Downstream region at tRNA end position |
cattataatc |
Secondary structure (Cloverleaf model) | >WENV180004176 Leu CAA t ACCA cattataatc G - C C - G C - G T - A G + T G - C G - C T G T C A G C C A T A A G | | | | | G T A G C G G T C G G C G | | | T T G A C G C T A G A CGGTGAATAACCGT G - C C - G G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |