| Sequence ID | >WENV180004391 |
| Genome ID | FLRS01001227 |
| Phylum/Class | [FLRS] metagenome; saliva |
| Species | |
| Start position on genome | 1200 |
| End posion on genome | 1124 |
| Amino Acid | Arg |
| Anticodon | CCT |
| Upstream region at tRNA start position |
atggttgtac |
| tRNA gene sequence |
GCCTCGGTAGCTCAACTGGATAGAGCAGATCCGTCCTAAGGATAAGGTTGTAGGTTCGAC |
| Downstream region at tRNA end position |
tatatatgac |
| Secondary structure (Cloverleaf model) | >WENV180004391 Arg CCT
c ACCA tatatatgac
G + T
C - G
C - G
T + G
C - G
G - C
G - C T C
T C G T C C A
C A A A | + | | | G
T C T C G G T A G G C
G | | | | T T
G G A G C
A T A A AGGTT
G A
A - T
T - A
C - G
C - G
G A
T A
C C T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |