Sequence ID | >WENV180006807 |
Genome ID | FLRZ01000617 |
Search identical group | |
Phylum/Class | [FLRZ] metagenome; saliva |
Species | |
Start position on genome | 1104 |
End posion on genome | 1181 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
ttaaaagata |
tRNA gene sequence |
CGGGATGTAGTTCAGTAGGTTTAGAATGCTGGTCTGGGGGACCAGTGGTCGCCAGTTCGA |
Downstream region at tRNA end position |
agaaacattg |
Secondary structure (Cloverleaf model) | >WENV180006807 Pro GGG a ACCA agaaacattg C - G G - C G - C G - C A - T T - A G - C T G T T G G T C A A T G A A + | | | | G G C T T G G C C A G C G | | | + T T T G A A T T T A G TGGTC C - G T - A G - C G - C T - A C G T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |