| Sequence ID | >WENV180015712 |
| Genome ID | FSTA01000307 |
| Phylum/Class | [FSTA] metagenome; soil |
| Species | |
| Start position on genome | 2910 |
| End posion on genome | 2991 |
| Amino Acid | Leu |
| Anticodon | GAG |
| Upstream region at tRNA start position |
cacccttcct |
| tRNA gene sequence |
GCACTCGTGGCGAAATGGCAGACGCGCACGCTTGAGGTGCGTGTGGAGAAATCCATGGGA |
| Downstream region at tRNA end position |
ttcacctcat |
| Secondary structure (Cloverleaf model) | >WENV180015712 Leu GAG
t ACtt ttcacctcat
G - C
C - G
A - T
C - G
T - A
C - G
G - C T G
T C C C T C A
T A A G | | | | | G
G A G C G G G G A G C
G | | | T T
C A C G C
A G G TGGAGAAATCCAT
C - G
A - T
C - G
G - C
C - G
T T
T G
G A G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |