| Sequence ID | >WENV180015718 |
| Genome ID | FSTB01000088 |
| Phylum/Class | [FSTB] metagenome; soil |
| Species | |
| Start position on genome | 3468 |
| End posion on genome | 3395 |
| Amino Acid | Cys |
| Anticodon | GCA |
| Upstream region at tRNA start position |
cgctcggtga |
| tRNA gene sequence |
GGCCACGTGGCGGAGTGGTTACGCAGCGGATTGCAAATCCGTGTATTCCGGTTCGATTCC |
| Downstream region at tRNA end position |
agcattcccc |
| Secondary structure (Cloverleaf model) | >WENV180015718 Cys GCA
a TCCA agcattcccc
G - C
G - C
C - G
C - G
A - T
C - G
G - C T T
T A G G C C A
G A G | | | | | G
T G G C G T C C G G C
G | | | T T
G A C G C
T T A GTAT
G + T
C - G
G - C
G - C
A - T
T A
T A
G C A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |