| Sequence ID | >WENV180015881 |
| Genome ID | FSTP01000370 |
| Phylum/Class | [FSTP] metagenome; soil |
| Species | |
| Start position on genome | 1210 |
| End posion on genome | 1135 |
| Amino Acid | Thr |
| Anticodon | TGT |
| Upstream region at tRNA start position |
ggcgggattg |
| tRNA gene sequence |
GCCGGTTTAGCTCAGCTGGTAGAGCAGCGGTTTTGTAAACCGAAGGTCACGGGTTCGATT |
| Downstream region at tRNA end position |
cttccttcct |
| Secondary structure (Cloverleaf model) | >WENV180015881 Thr TGT
g ACCA cttccttcct
G - C
C - G
C - G
G - C
G - C
T - A
T - A T T
T T G T C C A
C G A A | | + | | G
T C T C G A C G G G C
G | | | | T T
G G A G C
T A A AGGTC
G A
C - G
G - C
G - C
T - A
T A
T A
T G T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |