Sequence ID | >WENV180016141 |
Genome ID | FSUD01000534 |
Search identical group | |
Phylum/Class | [FSUD] metagenome; soil |
Species | |
Start position on genome | 2363 |
End posion on genome | 2438 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
gccgaaaaat |
tRNA gene sequence |
GCCGGTTTAGCTCAGTTGGTAGAGCGCCAGTTTTGTAAACTGGATGTCGTGGGTTCGATT |
Downstream region at tRNA end position |
cttttcgcgg |
Secondary structure (Cloverleaf model) | >WENV180016141 Thr TGT t ACCA cttttcgcgg G - C C - G C - G G - C G - C T - A T - A T T T C A T C C A T G A A | | + | | G T C T C G G T G G G C G | | | | T T G G A G C T A G ATGTC C - G C - G A - T G - C T - A T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |