| Sequence ID | >WENV180016287 |
| Genome ID | FSUP01000188 |
| Phylum/Class | [FSUP] metagenome; soil |
| Species | |
| Start position on genome | 2615 |
| End posion on genome | 2704 |
| Amino Acid | Ser |
| Anticodon | CGA |
| Upstream region at tRNA start position |
cacccaagtc |
| tRNA gene sequence |
GGAGAGGTGGCTGAGCGGTTGAAAGCACCGCACTCGAAATGCGGCATACTCGTAAGGGTA |
| Downstream region at tRNA end position |
tcgctctttc |
| Secondary structure (Cloverleaf model) | >WENV180016287 Ser CGA
c GCCA tcgctctttc
G - C
G - C
A - T
G - C
A - T
G - C
G - C T A
T C G C C C A
C G A G | | | | | G
G G T C G G C G G G C
G | | | T T
T A A G C
T G A A CATACTCGTAAGGGTATC
C - G
C - G
G - C
C - G
A - T
C A
T A
C G A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |