| Sequence ID | >WENV180016601 |
| Genome ID | FSVL01000100 |
| Phylum/Class | [FSVL] metagenome; soil |
| Species | |
| Start position on genome | 4076 |
| End posion on genome | 4150 |
| Amino Acid | Thr |
| Anticodon | CGT |
| Upstream region at tRNA start position |
cgtcaacggt |
| tRNA gene sequence |
GCCGCCTTAGCTCAGTTGGCCAGAGCAACGCACTCGTAATGCGTAGGTCTCGGGTTCGAA |
| Downstream region at tRNA end position |
aaacgcccca |
| Secondary structure (Cloverleaf model) | >WENV180016601 Thr CGT
t CCtg aaacgcccca
G - C
C - G
C - G
G - C
C - G
C - G
T - A T A
T A G C C C A
T G A A | | | | | G
T C T C G T C G G G C
G | | | | T T
G G A G C
C C A A AGGTC
A - T
C - G
G - C
C - G
A - T
C A
T A
C G T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |