| Sequence ID | >WENV180017189 |
| Genome ID | FSWP01000696 |
| Phylum/Class | [FSWP] metagenome; soil |
| Species | |
| Start position on genome | 2 |
| End posion on genome | 78 |
| Amino Acid | Arg |
| Anticodon | ACG |
| Upstream region at tRNA start position |
nnnnnnnnnc |
| tRNA gene sequence |
GCGCCCGTAGCTCAGTTGGATAGAGCACCTGGCTACGAACTAGGGGGTCGGAGGTTCGAA |
| Downstream region at tRNA end position |
ttcgcttcaa |
| Secondary structure (Cloverleaf model) | >WENV180017189 Arg ACG
c ACCA ttcgcttcaa
G - C
C - G
G - C
C - G
C - G
C - G
G - C T A
T C T T C C A
T G A A | + | | | G
T C T C G G G A G G C
G | | | | T T
G G A G C
A T A A GGGTC
C - G
C - G
T - A
G + T
G - C
C A
T A
A C G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |