| Sequence ID | >WENV180017322 |
| Genome ID | FSWT01000203 |
| Phylum/Class | [FSWT] metagenome; soil |
| Species | |
| Start position on genome | 3096 |
| End posion on genome | 3020 |
| Amino Acid | Pro |
| Anticodon | GGG |
| Upstream region at tRNA start position |
tccttcgcgg |
| tRNA gene sequence |
CGGAGCGTGGCGCAGCCTGGTAGCGCACTTGACTGGGGGTCAAGGGGTCGCAGGTTCGAA |
| Downstream region at tRNA end position |
cacctcgatg |
| Secondary structure (Cloverleaf model) | >WENV180017322 Pro GGG
g ACCA cacctcgatg
C - G
G - C
G - C
A - T
G - C
C - G
G - C T A
T T G T C C A
C G A G + | | | | G
C C G C G G C A G G C
T | | | | T T
G G C G C
G T A A GGGTC
C - G
T - A
T - A
G - C
A - T
C G
T G
G G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |