| Sequence ID | >WENV180017705 |
| Genome ID | FSXN01000804 |
| Phylum/Class | [FSXN] metagenome; soil |
| Species | |
| Start position on genome | 1574 |
| End posion on genome | 1647 |
| Amino Acid | Cys |
| Anticodon | GCA |
| Upstream region at tRNA start position |
gctctccggc |
| tRNA gene sequence |
GGCCTGATGGCGGAGTGGTTACGCAGAGGACTGCAAATCCTTGCACCCGAGTTCGATTCT |
| Downstream region at tRNA end position |
cttattttga |
| Secondary structure (Cloverleaf model) | >WENV180017705 Cys GCA
c TCCA cttattttga
G - C
G - C
C - G
C - G
T - A
G - C
A - T T T
T G G C T C A
G A G | | | | | G
T G G C G C C G A G C
G | | | T T
G A C G C
T T A GCAC
G + T
A - T
G - C
G - C
A - T
C A
T A
G C A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |