| Sequence ID | >WENV180018123 |
| Genome ID | FSYK01000061 |
| Phylum/Class | [FSYK] metagenome; soil |
| Species | |
| Start position on genome | 78 |
| End posion on genome | 6 |
| Amino Acid | Met |
| Anticodon | CAT |
| Upstream region at tRNA start position |
aggatgtcac |
| tRNA gene sequence |
GCCAGGGTAGCTCAGCGGTAGAGCAGGGGACTCATAAGCCCTTGGTCGGGGGTTCGATTC |
| Downstream region at tRNA end position |
ctcnnnnnnn |
| Secondary structure (Cloverleaf model) | >WENV180018123 Met CAT
c ACtt ctcnnnnnnn
G - C
C - G
C - G
A - T
G - C
G + T
G - C T T
T C C C C C A
G A A | | | | | G
C C T C G G G G G G C
G | | | | T T
G G A G C
T A A TGGTC
G + T
G - C
G - C
G - C
A G
C A
T A
C A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |