Sequence ID | >WENV180018262 |
Genome ID | FSYS01003151 |
Search identical group | |
Phylum/Class | [FSYS] metagenome; soil |
Species | |
Start position on genome | 1688 |
End posion on genome | 1764 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
aaaacacctc |
tRNA gene sequence |
GGCGGTGTAGCTCAGATGGTTAGAGCGACGGACTCATAACCCGTAGGTCGGCAGTTCGAT |
Downstream region at tRNA end position |
aacgacatcc |
Secondary structure (Cloverleaf model) | >WENV180018262 Met CAT c ACCA aacgacatcc G - C G - C C - G G - C G - C T - A G - C T T T C C G T C A A G A A | | | | | G T C T C G G G C A G C G | | | | T T G G A G C T T A G AGGTC A - T C - G G - C G - C A C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |