Sequence ID | >WENV180020295 |
Genome ID | FTCZ01001293 |
Search identical group | |
Phylum/Class | [FTCZ] metagenome; soil |
Species | |
Start position on genome | 2389 |
End posion on genome | 2315 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
cctttccgga |
tRNA gene sequence |
GCCGGTTTAGCTCAGCGGTAGAGCAGCGGTTTTGTAAACCGAAGGTCGGGGGTTCAATCC |
Downstream region at tRNA end position |
tttgatccga |
Secondary structure (Cloverleaf model) | >WENV180020295 Thr TGT a ACCA tttgatccga G - C C - G C - G G - C G - C T - A T - A C T T C T C C C A G A A | + | | | A C C T C G G G G G G C G | | | | T T G G A G C T A A AGGTC G A C - G G - C G - C T - A T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |