Sequence ID | >WENV180020857 |
Genome ID | FTDD01000114 |
Search identical group | |
Phylum/Class | [FTDD] metagenome; soil |
Species | |
Start position on genome | 4441 |
End posion on genome | 4525 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
ttggcggcgt |
tRNA gene sequence |
GCGGATGTGGCGGAACTGGTAGACGCACTGGGTTTAGGTTCCAGCGCCGCAAGGCGTGGA |
Downstream region at tRNA end position |
gcgcnnnnnn |
Secondary structure (Cloverleaf model) | >WENV180020857 Leu TAG t ACCA gcgcnnnnnn G - C C - G G - C G - C A - T T - A G - C T G T T C T C C A C A A G + | | | | G T G G C G G G A G G C G | | | T T G A C G C T A G A CGCCGCAAGGCGT C - G T - A G - C G - C G + T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |