| Sequence ID | >WENV180021735 |
| Genome ID | FTFB01006789 |
| Phylum/Class | [FTFB] metagenome; soil |
| Species | |
| Start position on genome | 5425 |
| End posion on genome | 5336 |
| Amino Acid | Ser |
| Anticodon | GGA |
| Upstream region at tRNA start position |
ccattcgaac |
| tRNA gene sequence |
GGAGAGATGTCCGAGTGGTTGAAGGAGCACGCTTGGAAAGCGTGTGTAGGGGAAACTCTA |
| Downstream region at tRNA end position |
tcctcaccat |
| Secondary structure (Cloverleaf model) | >WENV180021735 Ser GGA
c GCCA tcctcaccat
G - C
G - C
A - T
G - C
A - T
G - C
A - T T A
T C T C C C A
T G A G | | | | | G
G G C C T G A G G G C
G | | | T T
T A G G A
T G A G TGTAGGGGAAACTCTACC
C - G
A - T
C - G
G - C
C - G
T A
T A
G G A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |