Sequence ID | >WENV180021760 |
Genome ID | FTFB01007934 |
Search identical group | |
Phylum/Class | [FTFB] metagenome; soil |
Species | |
Start position on genome | 773 |
End posion on genome | 698 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
ttgcatcagt |
tRNA gene sequence |
GGGGCCATAGCTCAGCTGGGAGAGCGCTACAATGGCATTGTAGAGGTCGGCGGTTCGATC |
Downstream region at tRNA end position |
acttccgctc |
Secondary structure (Cloverleaf model) | >WENV180021760 Ala GGC t ACCA acttccgctc G - C G - C G + T G - C C - G C - G A - T C T T C C G C C A C G A A | | | | | G T C T C G G G C G G C G | | | | T T G G A G C G A G AGGTC C - G T - A A - T C - G A - T A T T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |