Sequence ID | >WENV180024569 |
Genome ID | FTIH01322214 |
Search identical group | |
Phylum/Class | [FTIH] metagenome; soil |
Species | |
Start position on genome | 85 |
End posion on genome | 13 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
ttccgatcta |
tRNA gene sequence |
GCTCGCGTGGCGTAATGGCAACGCGTCTGACTTCTAATCAGAAGATTATGGGTTCGACCC |
Downstream region at tRNA end position |
tgtttcttcc |
Secondary structure (Cloverleaf model) | >WENV180024569 Arg TCT a GCtt tgtttcttcc G + T C - G T - A C - G G + T C - G G - C C C T T A C C C A A A G | | | | | G T T G C G A T G G G C G | | | | T T G A C G C C A G AGATT T - A C - G T - A G - C A - T C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |