Sequence ID | >W141000935 |
Genome ID | ADEW01000012 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Gardnerella vaginalis 6119V5 [ADEW] |
Start position on genome | 23347 |
End posion on genome | 23420 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
ttgctatttt |
tRNA gene sequence |
GCGGACGTAGCTCAATGGTAGAGTCTCAGTCTTCCAAACTGATTACGCGGGTTCGATTCC |
Downstream region at tRNA end position |
ctttttgaaa |
Secondary structure (Cloverleaf model) | >W141000935 Gly TCC t TCCA ctttttgaaa G - C C - G G - C G - C A - T C - G G - C T T T T G C C C A A A A + | | | | G T C T C G G C G G G C G | | | + T T G G A G T T A C TTAC T - A C - G A - T G - C T - A C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |