Sequence ID | >WENV180028103 |
Genome ID | FTIZ01751685 |
Search identical group | |
Phylum/Class | [FTIZ] metagenome; soil |
Species | |
Start position on genome | 5920 |
End posion on genome | 6004 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
cggatgacgt |
tRNA gene sequence |
GCGGTCGTGGCGGAATTGGTAGACGCGCAGCGTTGAGGTCGCTGTGCCGCAAGGCGTGGA |
Downstream region at tRNA end position |
tccgggggat |
Secondary structure (Cloverleaf model) | >WENV180028103 Leu GAG t ACCA tccgggggat G - C C - G G - C G - C T - A C - G G - C T G T T C T T C A T A A G + | | | | G T G G C G G G A A G C G | | | T T G A C G C T A G G TGCCGCAAGGCGT C - G A - T G - C C - G G - C T T T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |