Sequence ID | >WENV180029818 |
Genome ID | FTJL01006764 |
Search identical group | |
Phylum/Class | [FTJL] metagenome; soil |
Species | |
Start position on genome | 1940 |
End posion on genome | 2024 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
cgcgcgacat |
tRNA gene sequence |
GCCCAGGTGGCGGAATTGGTAGACGCGCTGGTTTCAGGTACCAGTGATGCAAGTCGTGGA |
Downstream region at tRNA end position |
ccccctcccg |
Secondary structure (Cloverleaf model) | >WENV180029818 Leu CAG t ACCA ccccctcccg G - C C - G C - G C - G A - T G - C G - C T G T T C T C C A T A A G + | | | | G T G G C G G G A G G C G | | | T T G A C G C T A G G TGATGCAAGTCGT C - G T - A G - C G - C T - A T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |