Sequence ID | >WENV180032439 |
Genome ID | FTJZ01205916 |
Search identical group | |
Phylum/Class | [FTJZ] metagenome; soil |
Species | |
Start position on genome | 222 |
End posion on genome | 149 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
tggataaagt |
tRNA gene sequence |
TGGGAGGTCGTCTAACGGTAAGACTGCGGCCTCTGGAGCCGCGTATCGGGGTTCGAATCC |
Downstream region at tRNA end position |
cttccgcacg |
Secondary structure (Cloverleaf model) | >WENV180032439 Gln CTG t GCCA cttccgcacg T - A G - C G - C G - C A - T G - C G - C T A T G T C C C A A A C | + | | | G C T C T G C G G G G C G | | | | T T G A G A C T A T GTAT G - C C - G G - C G - C C - G C A T G C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |