| Sequence ID | >WENV180034108 |
| Genome ID | FTKM01680081 |
| Phylum/Class | [FTKM] metagenome; soil |
| Species | |
| Start position on genome | 16563 |
| End posion on genome | 16489 |
| Amino Acid | Arg |
| Anticodon | TCT |
| Upstream region at tRNA start position |
tcagtttcgc |
| tRNA gene sequence |
CTCCCCATAGTTCAACGGATAGAACACGGGTCTTCTAAACCTGAAATCGAGGTTCGATTC |
| Downstream region at tRNA end position |
ccatcggttc |
| Secondary structure (Cloverleaf model) | >WENV180034108 Arg TCT
c GCCA ccatcggttc
C - G
T + G
C - G
C - G
C - G
C - G
A - T T T
T G C T C C A
C A A A | | | | | G
G C T T G C G A G G C
G | | | | T T
A G A A C
T A A AAAT
C - G
G + T
G - C
G - C
T - A
C A
T A
T C T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |