Sequence ID | >WENV180035251 |
Genome ID | FTKT01035302 |
Search identical group | |
Phylum/Class | [FTKT] metagenome; soil |
Species | |
Start position on genome | 519 |
End posion on genome | 595 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tggcaggctt |
tRNA gene sequence |
GGCGCTTTAGCTCAGCCGGTTAGAGCGACGGAATCATAATCCGCAGGTCCGGGGTTCGAA |
Downstream region at tRNA end position |
gtccaagaag |
Secondary structure (Cloverleaf model) | >WENV180035251 Met CAT t ACCA gtccaagaag G - C G - C C - G G - C C - G T - A T - A T A T G T C C C A C G A A | + | | | G C C T C G C G G G G C G | | | | T T G G A G C T T A G AGGTC A C C - G G - C G - C A - T A A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |