Sequence ID | >WENV180042248 |
Genome ID | LQAE01000037 |
Phylum/Class | [LQAE] bioreactor metagenome; bioreactor_1 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 393 |
End posion on genome | 318 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
tttttttgcg |
tRNA gene sequence |
GTGGGTGTAGCTCAGTTGGTAGAGCACCAGGTTGTGGCCCTGGTGGCCGCGGGTTCAAGT |
Downstream region at tRNA end position |
ctatattagt |
Secondary structure (Cloverleaf model) | >WENV180042248 His GTG g CCCA ctatattagt G - C T - A G - C G + T G - C T - A G - C T G T T G C C C A T G A A + | | | | A T C T C G G C G G G C G | | | | T T G G A G C T A A TGGCC C - G C - G A - T G - C G - C T C T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |