Sequence ID | >WENV180042254 |
Genome ID | LQAE01000043 |
Phylum/Class | [LQAE] bioreactor metagenome; bioreactor_1 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 26208 |
End posion on genome | 26283 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
agccgttaat |
tRNA gene sequence |
GCGGGTATAACTCAGGTGGTAGAGTGCAAGCTTCCCAAGCTTGATGTCGCGAGTTCGAGT |
Downstream region at tRNA end position |
cccttaatta |
Secondary structure (Cloverleaf model) | >WENV180042254 Gly CCC t TCCA cccttaatta G - C C - G G - C G - C G - C T + G A - T T G T T G C T C A G G A A + | | | | G T C T C A G C G A G C G | | | | T T G G A G T T A G ATGTC C - G A - T A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |