Sequence ID | >WENV180042286 |
Genome ID | LQAE01000152 |
Phylum/Class | [LQAE] bioreactor metagenome; bioreactor_1 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 412 |
End posion on genome | 486 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
ctaaaaatta |
tRNA gene sequence |
GCGGAAGTGGCTCAGTGGTAGAGCATCGCCTTGCCAAGGCGAGGGTCGCGAGTTCGAATC |
Downstream region at tRNA end position |
atttatgcgg |
Secondary structure (Cloverleaf model) | >WENV180042286 Gly GCC a TCCA atttatgcgg G - C C - G G - C G - C A - T A - T G - C T A T T G C T C A G A G + | | | | G T C T C G G C G A G C G | | | | T T G G A G C T A A GGGTC T - A C - G G - C C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |