Sequence ID | >WENV180042350 |
Genome ID | LQAE01003809 |
Phylum/Class | [LQAE] bioreactor metagenome; bioreactor_1 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 192 |
End posion on genome | 264 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
cccgctcaac |
tRNA gene sequence |
GCCGATGTAGCTCAGTGGTAGAGCGCTTCCTTGGTAAGGAAGAGGTCACGAGTTCAATCC |
Downstream region at tRNA end position |
gtttatttaa |
Secondary structure (Cloverleaf model) | >WENV180042350 Thr GGT c TCaa gtttatttaa G - C C - G C - G G + T A - T T - A G - C C T T T G C T C A G A A | | | | | A T C T C G A C G A G C G | | | | T T G G A G C T A G AGGTC C - G T - A T - A C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |