Sequence ID | >WENV180042367 |
Genome ID | LQAE01007086 |
Phylum/Class | [LQAE] bioreactor metagenome; bioreactor_1 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 574 |
End posion on genome | 498 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
cgccctcagt |
tRNA gene sequence |
GCCGCCTTAGCTCAGTAGGTTAGAGCGCCTGATTGTGGATCAGGAGGTCCCCCGTTCGAG |
Downstream region at tRNA end position |
ctctttcctt |
Secondary structure (Cloverleaf model) | >WENV180042367 His GTG t ACCA ctctttcctt G + T C - G C - G G + T C - G C - G T - A C G T G G G G C A T G A A | | | | | G A C T C G C C C C G C G | | | | T T G G A G C T T A G AGGTC C - G C - G T - A G - C A - T T A T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |