Sequence ID | >WENV180042407 |
Genome ID | LQAE01015073 |
Phylum/Class | [LQAE] bioreactor metagenome; bioreactor_1 inoculated with Wadden Sea sediment; 1st replicate of a sulfate-reducing system that |
Species | |
Start position on genome | 80 |
End posion on genome | 6 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
actctttttc |
tRNA gene sequence |
GGGGCATTAGCTCAGTTGGCTAGAGCGTTTGACTGGCAGTCAAGAGGTCATCGGTTCGAC |
Downstream region at tRNA end position |
aaannnnnnn |
Secondary structure (Cloverleaf model) | >WENV180042407 Ala GGC c ACtg aaannnnnnn G - C G - C G + T G - C C - G A - T T - A T C T T A G C C A T G A A | | | | | G T C T C G A T C G G C G | | | | T T G G A G C C T A G AGGTC T + G T - A T - A G - C A - T C G T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |